Sequence ID | >WENV170644662 |
Genome ID | JMBW01052945 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 149 |
End posion on genome | 222 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
ttgcgtccgt |
tRNA gene sequence |
TGGGGAGTCGTCTAGTGGTAGGACGTCAGACTCTGGATCTGATTGCGAGGGTTCGAATCC |
Downstream region at tRNA end position |
atttcatggc |
Secondary structure (Cloverleaf model) | >WENV170644662 Gln CTG t GCCA atttcatggc T - A G - C G - C G - C G - C A - T G - C T A T C T T C C A G A C | | + | | G T T C T G G A G G G C G + | | | T T G G G A C T A G TTGC T - A C - G A - T G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |