Sequence ID | >WENV170644663 |
Genome ID | JMBW01052961 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 300 |
End posion on genome | 223 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tatataatct |
tRNA gene sequence |
CGGGGTATAGCGTAGTCCGGTTAGCGCGCCTGCTTTGGGAGCAGGAGGTCGTAAGTTCGA |
Downstream region at tRNA end position |
caactgaaaa |
Secondary structure (Cloverleaf model) | >WENV170644663 Pro TGG t CCGA caactgaaaa C C G - C G - C G - C G - C T - A A - T T A T C A T T C A C T G A A | | | | | G C T G C G G T A A G C G + | | | T T G G C G C T T A G AGGTC C - G C - G T - A G - C C - G T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |