Sequence ID | >WENV170644664 |
Genome ID | JMBW01053464 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 164 |
End posion on genome | 89 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tttttatatc |
tRNA gene sequence |
GGAGAATTAGCTCAGTTGGGAGAGCACCTGCCTTACAAGCAGGGGGGGGTCACTGGTTCG |
Downstream region at tRNA end position |
ttgagccatt |
Secondary structure (Cloverleaf model) | >WENV170644664 Val TAC c Attt ttgagccatt G - C G - C A - T G - C A - T A - T T - A C G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C G A A GGGGGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |