Sequence ID | >WENV170644666 |
Genome ID | JMBW01054095 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 220 |
End posion on genome | 146 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
taggcagaca |
tRNA gene sequence |
CGGCTCGTGGTCTAGCTGGTTATGACGTCGCCTTGACATGGCGGAGGTCCTGAGTTCGAA |
Downstream region at tRNA end position |
cttttgggaa |
Secondary structure (Cloverleaf model) | >WENV170644666 Val GAC a ACtt cttttgggaa C C G - C G - C C - G T - A C - G G - C T A T G A C T C A C G A G | | | | | G T T C T G C T G A G C G | | | T T G T G A C T T A G AGGTC T + G C - G G - C C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |