Sequence ID | >WENV170644668 |
Genome ID | JMBW01054144 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 217 |
End posion on genome | 140 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aagtttgagc |
tRNA gene sequence |
GGAGGCGTGGTGTAGCTGGTCTAACATACCTGCCTGTCACGCAGGAGATCGCGGGTTCGA |
Downstream region at tRNA end position |
ttttatgtac |
Secondary structure (Cloverleaf model) | >WENV170644668 Asp GTC c GCCA ttttatgtac G - C G - C A - T G + T G - C C - G G - C T A T T G C C C A T C G A G + | | | | G G T G T G G C G G G C G | | | + T T T A C A T C T A A AGATC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |