Sequence ID | >WENV170644671 |
Genome ID | JMBW01054661 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 194 |
End posion on genome | 283 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
caaaatgcag |
tRNA gene sequence |
GGAGAGATGGCAGAGTGGTCGATCGCGGCGGTCTTGAAAACCGTTGAACTGAGAGGTTCC |
Downstream region at tRNA end position |
aaatgtttga |
Secondary structure (Cloverleaf model) | >WENV170644671 Ser TGA g GCGA aaatgtttga G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | + | | | G G G A C G G G G G G C G + | | T T T T C G C C G A G TGAACTGAGAGGTTCCGG G + T C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |