Sequence ID | >WENV170644674 |
Genome ID | JMBW01055263 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 54 |
End posion on genome | 129 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
agatataaac |
tRNA gene sequence |
GCCCATATAGCTCAGTCGGCAGAGCGCATCCTTGGTAAGGATGAGGTCATCGGTTCAAGT |
Downstream region at tRNA end position |
tctggcggcg |
Secondary structure (Cloverleaf model) | >WENV170644674 Thr GGT c TCCA tctggcggcg G - C C - G C - G C - G A - T T - A A - T T G T T A G C C A T G A A | | | | | A C C T C G A T C G G C G | | | | T T G G A G C C A G AGGTC C - G A - T T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |