Sequence ID | >WENV170644675 |
Genome ID | JMBW01055263 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 133 |
End posion on genome | 209 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ggctccatct |
tRNA gene sequence |
GGCGGCGTAGCTCAGCTGGCTAGAGCATACGGTTCATACCCGTAGTGTCAGGGGTTCAAG |
Downstream region at tRNA end position |
tatagaggac |
Secondary structure (Cloverleaf model) | >WENV170644675 Met CAT t ACCA tatagaggac G + T G - C C - G G - C G - C C - G G - C T G T T T C C C A C G A A | + | | | A T C T C G A G G G G C G | | | | T T G G A G C C T A A GTGTC T - A A - T C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |