Sequence ID | >WENV170644676 |
Genome ID | JMBW01055292 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 81 |
End posion on genome | 154 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
acataaggat |
tRNA gene sequence |
TGTCCCATGGTGTAATGGTAGCACATCTGATTTTGGTTCAGCCAGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
caaaaacgct |
Secondary structure (Cloverleaf model) | >WENV170644676 Gln TTG t ACAA caaaaacgct T - A G - C T - A C - G C - G C - G A - T T A T G G T C C A A A G | + | | | G T T G T G C T A G G C G + | | | T T G G C A C T A A CAGT T C C - G T - A G - C A - T T T T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |