Sequence ID | >WENV170644677 |
Genome ID | JMBW01055452 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 209 |
End posion on genome | 137 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
tttatctata |
tRNA gene sequence |
CGGGAAGTGGCTCAGCTTGGTAGAGCACCTGGTTTGGGACCAGGGGTCGCAGGTTCAAGT |
Downstream region at tRNA end position |
atggcggcgt |
Secondary structure (Cloverleaf model) | >WENV170644677 Pro TGG a Ataa atggcggcgt C - G G - C G - C G - C A - T A - T G - C T G T T G T C C A C G A G + | | | | A T C T C G G C A G G C T | | | | T T G G A G C G T A A GGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |