Sequence ID | >WENV170644679 |
Genome ID | JMBW01055816 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 118 |
End posion on genome | 43 |
Amino Acid | Ala |
Anticodon | GGC |
Upstream region at tRNA start position |
caaatgtggg |
tRNA gene sequence |
GGGGCTATGGCGCAGCTGGGAGCGCGCTTGAATGGCATTCAAGAGGTCGAGGGTTCGAAT |
Downstream region at tRNA end position |
ttatttattt |
Secondary structure (Cloverleaf model) | >WENV170644679 Ala GGC g ACCA ttatttattt G - C G - C G + T G - C C - G T - A A - T T A T C T C C C A C G A G | | | | | G T C G C G G A G G G C G | | | | T T G G C G C G A G AGGTC C - G T - A T - A G - C A - T A T T A G G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |