Sequence ID | >WENV170644680 |
Genome ID | JMBW01055904 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 64 |
End posion on genome | 140 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tttcttcaga |
tRNA gene sequence |
GGGCCTATAGCTCAGTTGGTTAGAGCAACTGACTCATAATCAGTAGGTCGCTGGTTCAAG |
Downstream region at tRNA end position |
ataaaaggaa |
Secondary structure (Cloverleaf model) | >WENV170644680 Met CAT a ACAA ataaaaggaa G - C G - C G - C C - G C - G T + G A - T T G T C G A C C A T G A A | | | | | A T C T C G G C T G G C G | | | | T T G G A G C T T A A AGGTC A - T C - G T - A G - C A - T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |