Sequence ID | >WENV170644683 |
Genome ID | JMBW01056937 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 136 |
End posion on genome | 62 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aattaactat |
tRNA gene sequence |
TCCGAAGTAGCTCAGCGGTAGAGCAGTTGGCTGTTAACCAATTGGTCACAGGTTCGAATC |
Downstream region at tRNA end position |
tttttgtttg |
Secondary structure (Cloverleaf model) | >WENV170644683 Asn GTT t GCCA tttttgtttg T - A C - G C - G G - C A - T A - T G - C T A T T G T C C A G A A | | | | | G C C T C G A C A G G C G | | | | T T G G A G C T A A TGGTC G + T T - A T - A G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |