Sequence ID | >WENV170644684 |
Genome ID | JMBW01056960 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 158 |
End posion on genome | 232 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
agcttattcg |
tRNA gene sequence |
GCCGACGTAGCTCAACGGCAGAGCAGCTGATTTGTAATCAGCAGGTTACCAGTTCAAATC |
Downstream region at tRNA end position |
tttaagaatg |
Secondary structure (Cloverleaf model) | >WENV170644684 Thr TGT g TCCA tttaagaatg G - C C - G C - G G - C A - T C - G G - C T A T T G G T C A A A A | | | | | A C C T C G A C C A G C G | | | | T T G G A G C C A A AGGTT G - C C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |