Sequence ID | >WENV170644688 |
Genome ID | JMBW01058520 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 166 |
End posion on genome | 241 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
tcagtgaggG |
tRNA gene sequence |
GGGGTCGTAGGGTAGCCTGGACATCCTATGGCGTTCGGGACGCTGTAACCTGAGTTCAAA |
Downstream region at tRNA end position |
ttattaaagt |
Secondary structure (Cloverleaf model) | >WENV170644688 Pro CGG G TTta ttattaaagt G A G - C G - C G - C T - A C - G G - C T A T G A C T C A C C G A A | | | | | A T T G G G C T G A G C G | | + T T G T C C T A C A A TAAC T + G G + T G - C C - G G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |