Sequence ID | >WENV170644689 |
Genome ID | JMBW01058678 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 186 |
End posion on genome | 112 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
cgcacaatat |
tRNA gene sequence |
GCGCCCGTAGCTCAGTGGATAGAGCACCGGCCTCCGGAGCCGGGTGCGGAGGTTCGATTC |
Downstream region at tRNA end position |
taggaaatca |
Secondary structure (Cloverleaf model) | >WENV170644689 Arg CCG t ACCA taggaaatca G + T C - G G - C C - G C - G C - G G - C T T T T C T C C A T G A A + | | | | G G C T C G G G A G G C G | | | | T T A G A G C T A A GTGC C - G C - G G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |