Sequence ID | >WENV170644691 |
Genome ID | JMBW01058986 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 162 |
End posion on genome | 237 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
caaccaaaat |
tRNA gene sequence |
GGTCCCATGGTGTAGTGGTTAACATGCCAGTCTGTCACACTGGAGATCGCGGGTTCAAGT |
Downstream region at tRNA end position |
tttttggctc |
Secondary structure (Cloverleaf model) | >WENV170644691 Asp GTC t GCCA tttttggctc G - C G - C T - A C - G C - G C - G A - T T G T T G C C C A T G A G + | | | | A G T G T G G C G G G C G | | | + T T T A C A T T A G AGATC C - G C - G A - T G - C T - A C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |