Sequence ID | >WENV170644693 |
Genome ID | JMBW01059308 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 256 |
End posion on genome | 339 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gaattaatat |
tRNA gene sequence |
GGAGGAGTTCCCGAGTTGGCTAAAGGGGGACGGACTGTAAATCCGTTGGCTAAGCCTTCA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170644693 Tyr GTA t Gnnn nnnnnnnnnn G - C G - C A - T G - C G - C A - T G - C T A T T G A C C A T T G A T | | | | | G G G C C C A C T G G C G | | | T T C G G G G T A A A G TGGCTAAGCCTTC A - T C - G G - C G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |