Sequence ID | >WENV170644694 |
Genome ID | JMBW01059534 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 204 |
End posion on genome | 282 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cacttaataa |
tRNA gene sequence |
GGAGTTATAGCTCAGCCGGGAGAGCGTCTGCTTGACGTGCAGAAAGTCGGGGGGGGTTCG |
Downstream region at tRNA end position |
ttgaatttga |
Secondary structure (Cloverleaf model) | >WENV170644694 Val GAC a ACCA ttgaatttga G - C G - C A - T G - C T - A T - A A - T T G T C T C C C A C G A A | + | | | G C C T C G G G G G G C G | | | | T T G G A G C G A G AAGTCGGG T - A C - G T - A G - C C - G T T T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |