Sequence ID | >WENV170644695 |
Genome ID | JMBW01059882 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 193 |
End posion on genome | 101 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
caatactttt |
tRNA gene sequence |
GGAGAGGTGGCTGAGTCTGGCCGAAGGCGCACGACTGGAAATCGTGTAAACGTGATGAGC |
Downstream region at tRNA end position |
atataatttt |
Secondary structure (Cloverleaf model) | >WENV170644695 Ser GGA t GCCA atataatttt G - C G - C A - T G - C A - T G - C G + T T A T C T C C C A C T G A G | | | | | G T G T C G G A G G G C G + | | T T G A G G C C C G A G TAAACGTGATGAGCGTTTC C - G A - T C - G G - C A - T C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |