Sequence ID | >WENV170644697 |
Genome ID | JMBW01060329 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 248 |
End posion on genome | 324 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tgccatggtt |
tRNA gene sequence |
GGCGGCGTAGCTCAGTTGGCTAGAGCATACGGTTCATACCCGTACGGTCACTGGTTCGAA |
Downstream region at tRNA end position |
acattctaag |
Secondary structure (Cloverleaf model) | >WENV170644697 Met CAT t ACCA acattctaag G - C G - C C - G G - C G - C C - G G - C T A T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C C T A A CGGTC T - A A - T C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |