Sequence ID | >WENV170644699 |
Genome ID | JMBW01060626 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 60 |
End posion on genome | 134 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
tttgcgttgg |
tRNA gene sequence |
GGGGGCGTAGCCAAGCGGTAAGGCACGGGACTTTGGATCCTGTATGCGTTGGTTCGAATC |
Downstream region at tRNA end position |
ctctactaat |
Secondary structure (Cloverleaf model) | >WENV170644699 Gln TTG g GCCA ctctactaat G A G - C G - C G - C G - C C - G G - C T A T C G A C C A G A A | + | | | G C A C C G G T T G G C G | | | T T G A G G C T A A TATGC C - G G + T G - C G - C A - T C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |