Sequence ID | >WENV170644702 |
Genome ID | JMBW01061466 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 169 |
End posion on genome | 94 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
ttagagacga |
tRNA gene sequence |
GCCCATGTAGCTCAGCAGGCAGAGCACATCCATGGTAAGGATGGGGTCGCCGGTTCGATT |
Downstream region at tRNA end position |
tttgaaattc |
Secondary structure (Cloverleaf model) | >WENV170644702 Thr GGT a TCCA tttgaaattc G - C C - G C - G C - G A - T T + G G - C T T T C G G C C A C G A A | | | | | G A C T C G G C C G G C G | | | | T T G G A G C C A A GGGTC C - G A - T T - A C - G C - G A A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |