Sequence ID | >WENV170644715 |
Genome ID | JMBW01069985 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 5 |
End posion on genome | 83 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
nnnnnnggct |
tRNA gene sequence |
GGCTCCGTAGCTCAATTGGATAGAGCATCTGACTACGGATCAGAAGGTTTGGGGGGTTCG |
Downstream region at tRNA end position |
aaatacaaag |
Secondary structure (Cloverleaf model) | >WENV170644715 Arg ACG t ACCT aaatacaaag G - C G + T C - G T - A C - G C - G G - C T G T T T C C C A T A A A + + | | | G T C T C G G G G G G C G | | | | T T G G A G C A T A A AGGTTTG T - A C - G T - A G - C A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |