Sequence ID | >WENV170644717 |
Genome ID | JMBW01070684 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 112 |
End posion on genome | 183 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
actttattgg |
tRNA gene sequence |
GGGGGCATGGTGCAATGGCAGCACACCGGACTTTGAATCCGTTGATCTTGGTTCGACTCC |
Downstream region at tRNA end position |
attactgtga |
Secondary structure (Cloverleaf model) | >WENV170644717 Gln TTG g GCtg attactgtga G G G - C G - C G - C G - C C - G A - T T C T G A A C C A A A G | | | | | G T C G T G C T T G G C G | | | | T T G G C A C C A A TGAT C T C - G G - C G - C A - T C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |