Sequence ID | >WENV170644722 |
Genome ID | JMBW01073356 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 283 |
End posion on genome | 209 |
Amino Acid | Ala |
Anticodon | CGC |
Upstream region at tRNA start position |
atattgttat |
tRNA gene sequence |
GGGGCTGTAGCTCAGTGGGAGAGCGCCTGGTTCGCATTCAGGAGGTCGAGGGTTCAAGTC |
Downstream region at tRNA end position |
aattataggt |
Secondary structure (Cloverleaf model) | >WENV170644722 Ala CGC t ACCA aattataggt G - C G - C G + T G - C C - G T - A G - C T G T T T C C C A G A A + | | | | A T C T C G G A G G G C G | | | | T T G G A G C G A G AGGTC C - G C - G T - A G - C G + T T T T A C G C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |