Sequence ID | >WENV170644723 |
Genome ID | JMBW01073441 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 78 |
End posion on genome | 154 |
Amino Acid | Pro |
Anticodon | CGG |
Upstream region at tRNA start position |
agtgttgctt |
tRNA gene sequence |
CGGGATGTAGCGCAGTTTGGTAGCGCGTCTGGTTCGGGACCAGAAGGCCGCAGGTTCAAA |
Downstream region at tRNA end position |
ttttattttc |
Secondary structure (Cloverleaf model) | >WENV170644723 Pro CGG t ACCA ttttattttc C - G G - C G - C G - C A - T T - A G - C T A T T G T C C A T G A A + | | | | A T C G C G G C A G G C T | | | | T T G G C G C G T A G AGGCC T - A C - G T - A G - C G - C T A T G C G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |