Sequence ID | >WENV170644724 |
Genome ID | JMBW01073890 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 44 |
End posion on genome | 117 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
acatccttaT |
tRNA gene sequence |
GCGACTGTGGTTTAGTGGCTATGACCTGAGCTTCCCAAGCTTAGAACCCGGGTTCGAATC |
Downstream region at tRNA end position |
gaaaatcttt |
Secondary structure (Cloverleaf model) | >WENV170644724 Gly CCC T ATtg gaaaatcttt G - C C - G G - C A - T C - G T - A G - C T A T G G C C C A T G A G | | | | | G G T T T G C C G G G C G + | | T T C T G A C T A C GAAC T - A G + T A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |