Sequence ID | >WENV170644731 |
Genome ID | JMBW01076015 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 259 |
End posion on genome | 179 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
ccatgtgggg |
tRNA gene sequence |
GGGCCATTAGCTCAGGGGGGGTAGAGCACCCGCCTTTTAAGCGGGGGGGAGTCGATGGTT |
Downstream region at tRNA end position |
tttctctctt |
Secondary structure (Cloverleaf model) | >WENV170644731 Lys TTT g ACCA tttctctctt G - C G - C G - C C - G C - G A - T T - A T A T C T A C C A G G G A A | | | | | G G C T C G G A T G G C G | | | | T T G G A G C G T A A GGGGAGTC C - G C - G C - G G - C C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |