Sequence ID | >WENV170644732 |
Genome ID | JMBW01076095 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 20 |
End posion on genome | 98 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cttaatgcgg |
tRNA gene sequence |
GCCCGCTTAGCTCAGTTGGCAGAGCACCATCCTTGTAAGTTGGGGGGGGTCGTTGGTTCG |
Downstream region at tRNA end position |
tatatgacag |
Secondary structure (Cloverleaf model) | >WENV170644732 Thr TGT g TCCA tatatgacag G - C C - G C - G C - G G - C C - G T - A T A T C A G C C A T G A A | | + | | G T C T C G G T T G G C G | | | | T T G G A G C C A A GGGGGGTC C - G C - G A - T T T C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |