Sequence ID | >WENV170644734 |
Genome ID | JMBW01076262 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 198 |
End posion on genome | 123 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
atactgttgg |
tRNA gene sequence |
GGGGGTGTAGCCAAGCTGGTAAGGCAACGGACTTTGACTCCGTGATTCGTAGGTTCGAGT |
Downstream region at tRNA end position |
tttttatttg |
Secondary structure (Cloverleaf model) | >WENV170644734 Gln TTG g GCCA tttttatttg G A G - C G - C G - C G - C T - A G - C T G T C G T C C A C G A A | + | | | G T A C C G G T A G G C G | | | T T G A G G C T A A GATTC A - T C - G G - C G - C A - T C C T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |