Sequence ID | >WENV170644735 |
Genome ID | JMBW01076262 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 109 |
End posion on genome | 24 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
ttatttgtgg |
tRNA gene sequence |
GCGGCTGTGGCGGAATTGGCAGACGCGCTAGATTCAGGTTCTAGTGCCTTTTAGGCATGG |
Downstream region at tRNA end position |
tctatgttta |
Secondary structure (Cloverleaf model) | >WENV170644735 Leu CAG g ACCA tctatgttta G - C C - G G - C G - C C - G T - A G - C T A T T C T C C A T A A G + | | | | A T G G C G G G A G G C G | | | T T G A C G C C A G G TGCCTTTTAGGCAT C - G T - A A - T G - C A - T T T T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |