Sequence ID | >WENV170644738 |
Genome ID | JMBW01078032 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 168 |
End posion on genome | 91 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tcaattgcgt |
tRNA gene sequence |
CGGGGTGTAGCTCAGCTTGGTATGAGCGCTTCGTTGGGGACGAAGAGGCCGCTGGTTCGA |
Downstream region at tRNA end position |
tttttctata |
Secondary structure (Cloverleaf model) | >WENV170644738 Pro GGG t ACCA tttttctata C - G G - C G - C G + T G - C T - A G - C T A T T G A C C A T C G A A + | | | | G T C T C G G C T G G C G | | | | T T G G A G C T A T G AGGCC C - G T - A T - A C - G G - C T A T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |