Sequence ID | >WENV170644742 |
Genome ID | JMBW01079035 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 30 |
End posion on genome | 109 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
gcaaacaaat |
tRNA gene sequence |
GGCGGCGTAGCTCAGATGGTTAGAGCATGCGGTTCATACCCGCAGTGTCAGGGGGGGTTC |
Downstream region at tRNA end position |
ctagtatcca |
Secondary structure (Cloverleaf model) | >WENV170644742 Met CAT t ACCA ctagtatcca G + T G - C C - G G - C G - C C - G G - C T A T T T C C C A A G A A + + | | | A T C T C G G G G G G C G | | | | T T G G A G C T T A A GTGTCAGG T - A G - C C - G G - C G - C T C T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |