Sequence ID | >WENV170644743 |
Genome ID | JMBW01079152 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 39 |
End posion on genome | 114 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
catgaatttc |
tRNA gene sequence |
GTCCTCGTAGCTCAGGAGGTAGAGCAACTGACTTTTAATCAGTGGGTCGGACGTTCGAAT |
Downstream region at tRNA end position |
tcgcctgggt |
Secondary structure (Cloverleaf model) | >WENV170644743 Lys TTT c ACCA tcgcctgggt G - C T - A C - G C - G T - A C - G G - C T A T T C T G C A G G A A + | | | | G A C T C G G G A C G C G | | | | T T G G A G C T A A GGGTC A - T C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |