Sequence ID | >WENV170644744 |
Genome ID | JMBW01079152 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 117 |
End posion on genome | 203 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ggacaccatc |
tRNA gene sequence |
GCCTGGGTGGCGGAATAGGTAGACGCGCAGGACTTAAAATCCTGTAGTAGCAATACTGTG |
Downstream region at tRNA end position |
atctcataat |
Secondary structure (Cloverleaf model) | >WENV170644744 Leu TAA c ACCA atctcataat G - C C - G C - G T - A G + T G - C G - C T T T C G C C C A T A A G | | | | | A A G G C G G C G G G C G | | | T T G A C G C T A G G TAGTAGCAATACTGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |