Sequence ID | >WENV170644746 |
Genome ID | JMBW01080448 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 232 |
End posion on genome | 157 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tgtggacaaa |
tRNA gene sequence |
CGGAGCGTAGCGCAGTTGGTAGCGCGTCAGCATGGGGTGTTGAAGGTCGCTGGTTCAAAT |
Downstream region at tRNA end position |
aaaaaaagaa |
Secondary structure (Cloverleaf model) | >WENV170644746 Pro GGG a ACCA aaaaaaagaa C - G G - C G - C A - T G - C C - G G - C T A T T G A C C A T G A A + | | | | A T C G C G G C T G G C G | | | | T T G G C G C T A G AGGTC T - A C - G A - T G + T C - G A T T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |