Sequence ID | >WENV170644747 |
Genome ID | JMBW01080515 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 141 |
End posion on genome | 216 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
attgcttcaC |
tRNA gene sequence |
GCCCCTATGGTCTAGCGGTTAGGACGCAGCCCTTTCAAGGCTAAAACCCGGGTTCGAGTC |
Downstream region at tRNA end position |
taaaagctta |
Secondary structure (Cloverleaf model) | >WENV170644747 Glu TTC C GGCA taaaagctta G G C - G C - G C - G C - G T - A A - T T G T G G C C C A C G A G | | | | | G G T C T G C C G G G C G + | | | T T T G G A C T A G AAAC C A A - T G - C C - G C - G C A T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |