Sequence ID | >WENV170644753 |
Genome ID | JMBW01081608 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 105 |
End posion on genome | 180 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
acaataatat |
tRNA gene sequence |
GGGCGGTTAGCTCAGTCGGCTAGAGCGCTTGCTTGACATGCAAGAGGTCACAGGTTCAAG |
Downstream region at tRNA end position |
cgaagcatgg |
Secondary structure (Cloverleaf model) | >WENV170644753 Val GAC t CCAt cgaagcatgg G A G - C G - C C - G G - C G - C T - A T G T T G T C C A T G A A | | | | | A C C T C G A C A G G C G | | | | T T G G A G C C T A G AGGTC C - G T - A T - A G - C C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |