Sequence ID | >WENV170644757 |
Genome ID | JMBW01082670 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 170 |
End posion on genome | 257 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gatatataat |
tRNA gene sequence |
GCGAGGGTTGCCCAGCCAGGTCAAAGGCGATAGGTTCAGGGCCTATTCTCGTAGGAGTTC |
Downstream region at tRNA end position |
aacttttaca |
Secondary structure (Cloverleaf model) | >WENV170644757 Leu CAG t ACTA aacttttaca G - C C - G G - C A - T G - C G - C G - C T A T C A C G C A C C G A T | | | | | G A C C C G G T G C G C G | | | T T G A G G C T C A A G TCTCGTAGGAGTTC A - T T - A A - T G - C G - C T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |