Sequence ID | >WENV170644758 |
Genome ID | JMBW01082988 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 223 |
End posion on genome | 148 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
taatattatt |
tRNA gene sequence |
CGCGGGGTGGAGCAGTTGGCAGCTCGTCGGGCTCATAACCCGGAGGTCGTAGGTTCAAAT |
Downstream region at tRNA end position |
ttaacctgaa |
Secondary structure (Cloverleaf model) | >WENV170644758 Met CAT t GCAA ttaacctgaa C C G - C C C G - C G - C G - C G - C T A T C A T C C A T G A G | | | | | A T C G A G G T A G G C G | | | | T T G G C T C C A G AGGTC T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |