Sequence ID | >WENV170644759 |
Genome ID | JMBW01082988 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 110 |
End posion on genome | 33 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
aatttaaggC |
tRNA gene sequence |
CCCCCCGTAGTGTAGCGGTTTACCACGCCTGCCTGTCACGCAGGAGATCGCCGGTTCAAA |
Downstream region at tRNA end position |
ttatgcgggt |
Secondary structure (Cloverleaf model) | >WENV170644759 Asp GTC C GTCA ttatgcgggt C C C T C - G C - G C - G C - G G - C T A T T G G C C A C G A A + | | | | A G T G T G G C C G G C G | | | T T T C C A C T T A G AGATC C - G C - G T - A G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |