Sequence ID | >WENV170644762 |
Genome ID | JMBW01085721 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 183 |
End posion on genome | 107 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
cagataatac |
tRNA gene sequence |
GCGCCCGTAGCTCAGCTGGATAGAGTGCTTGACTACGAATCAAGAGGCCGCAGGTTCGAG |
Downstream region at tRNA end position |
tttataatgt |
Secondary structure (Cloverleaf model) | >WENV170644762 Arg ACG c GCCA tttataatgt G - C C - G G - C C - G C - G C - G G - C T G T C G T C C A C G A A | | | | | G T C T C G G C A G G C G | | | + T T G G A G T A T A G AGGCC C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |