Sequence ID | >WENV170644764 |
Genome ID | JMBW01085933 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 136 |
End posion on genome | 210 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
ggatggttgt |
tRNA gene sequence |
TCCGAGGTAGCTCAATGGTGGAGCAACCGGCTGTTAACCGGTAGGTCGTGGGTTCGAGCC |
Downstream region at tRNA end position |
ataaaattgc |
Secondary structure (Cloverleaf model) | >WENV170644764 Asn GTT t GCCA ataaaattgc T - A C - G C - G G - C A - T G - C G - C C G T C A C C C A A A A | | | | | G T C T C G G T G G G C G | | | | T T G G A G C T G A AGGTC A - T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |