Sequence ID | >WENV170644765 |
Genome ID | JMBW01086470 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 258 |
End posion on genome | 182 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
naattaaact |
tRNA gene sequence |
GGGGACGTGGTGAAGCTGGTTATCATGCCGGTCTGTCACACCGGTGGCCGCGGGTTCGAG |
Downstream region at tRNA end position |
ccatttatta |
Secondary structure (Cloverleaf model) | >WENV170644765 Asp GTC t CCCG ccatttatta G - C G - C G - C G - C A - T C - G G - C T G T T G C C C A C G A G + | | | | G T A G T G G C G G G C G | | | + T T G T C A T T T A G TGGCC C - G C - G G - C G - C T - A C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |