Sequence ID | >WENV170644767 |
Genome ID | JMBW01087132 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 135 |
End posion on genome | 60 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
gtgcagcggc |
tRNA gene sequence |
CCCCCCATCGTCTAGCGGTTCAGGACACCGCCCTCTCACGGCGGAGACACGGGTTCGAAT |
Downstream region at tRNA end position |
atattttaac |
Secondary structure (Cloverleaf model) | >WENV170644767 Glu CTC c GCCA atattttaac C T C C C - G C - G C - G C - G A - T T A T T G C C C A C G A C | | | | | G G T C T G A C G G G C G + | | | T T T G G A C T C A A AGAC C - G C - G G - C C - G C - G C C T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |