Sequence ID | >WENV170644773 |
Genome ID | JMBW01089429 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 227 |
End posion on genome | 153 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aataaaacat |
tRNA gene sequence |
TCCTAGGTAGCTCAACGGTGGAGCACCCGGCTGTTAACCGGTAGGTTGTGGGTTCGAATC |
Downstream region at tRNA end position |
aacttaattt |
Secondary structure (Cloverleaf model) | >WENV170644773 Asn GTT t GCCA aacttaattt T - A C - G C - G T + G A - T G - C G - C T A T C A C C C A A A A | | | | | G C C T C G G T G G G C G | | | | T T G G A G C T G A AGGTT C T C - G C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |