Sequence ID | >WENV170644774 |
Genome ID | JMBW01089569 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 147 |
End posion on genome | 221 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
aaagaagtgt |
tRNA gene sequence |
TCCTCGATAGCTCAGCGGTAGAGCATTCGGCTGTTAACCGAAGGGTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
ttttaatata |
Secondary structure (Cloverleaf model) | >WENV170644774 Asn GTT t GCCA ttttaatata T - A C - G C - G T - A C - G G - C A - T T A T C A T C C A G A A | | | | | G C C T C G G T A G G C G | | | | T T G G A G C T A A GGGTC T - A T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |