Sequence ID | >WENV170644776 |
Genome ID | JMBW01089953 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 55 |
End posion on genome | 133 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
aaacccataT |
tRNA gene sequence |
GCCCCGGTAGTCTAATGGATAAGACGGTGGATTCCGGATCCACTGATGCGGGTTCGATTC |
Downstream region at tRNA end position |
Aaaggcagca |
Secondary structure (Cloverleaf model) | >WENV170644776 Arg CCG T CGCC Aaaggcagca G G C - G C - G C - G C - G G G G G C C T C C C G T T T A A A | | | + T G T C T G G G G T T A G | | | | C G A A G A C T A G TGATGC G - C T - A G - C G - C A - T T A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |