Sequence ID | >WENV170644779 |
Genome ID | JMBW01091857 |
Phylum/Class | [JMBW] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 69 |
End posion on genome | 149 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cgccattcgt |
tRNA gene sequence |
GTCCCTATAGCTCAGTTGGATAGAGCGGGGGGGATTCCTAATCCCCGTCTGCCGGAGGTT |
Downstream region at tRNA end position |
agttttgtga |
Secondary structure (Cloverleaf model) | >WENV170644779 Arg CCT t GCCA agttttgtga G - C T - A C - G C - G C - G T - A A - T T G T C C T C C A T T G A A | | | | | G G C T C G G G A G G C G | | T T A G C G G T A G A G GTCTGCC G - C G - C G - C G - C A - T T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |